skorek laryngolog pruszcz gdański

Jądra oczyszczono z hodowanych komórek, jak opisano powyżej i albo zamrożono, albo ekstrahowano. Ekstrakty jądrowe wytworzono w 400 mM KCl buforowanym 20 mM HEPES pH 7,9 uzupełnionym koktajlem inhibitorów proteinazy (Sigma-Aldrich). Ekstrakty białkowe sprowadzono do 100 mM KCl i aktywność wiązania DNA zbadano przy użyciu następujących sond oligonukleotydowych: FTS-1 (Invitrogen), regularny: 5. CACTCACTACTTGATTGTGCCTGCT-3a, zmutowany: 5. -CACTCACTACCCAGCTGTGCCTGCT-3 .; Miejsce konsensusowe YB-1 (Santa Cruz Biotechnology Inc.), regularne: 5 (3 -AGACCGTACGTGATTGGTTAATCTCTT-3 (3, zmutowany: 5 (3 -AGACCGTACGTGTAACCATAATCTCTT-3; SRE (Santa Cruz Biotechnology Inc.), zwykły: 5 (3-GGATGTCCATATTAGGACATCT-3 (3, zmutowany: 5 (3-GGATGTCCATATTATTACATCT-3 .. EMSA przeprowadzono w sposób opisany uprzednio (60). W skrócie, 10-15 g białka inkubowano z 4 x 105 cpm [32P] końcowych znakowanych ATP oligonukleotydów w 20 mM HEPES pH 7,9 z 100 mM KCl, 20% glicerolu i 0,2 mM EDTA. W analizach kompetycyjnych białko preinkubowano z nieznakowanymi oligonukleotydami lub przeciwciałami. Kompleksy FTS-1 rozdzielono za pomocą 5% PAGE stosując 0,5 × bufor Tris-boran pH 7,8, wysuszono pod próżnią i poddano analizie PhosphorImager (GE HealthCare). Dwuwymiarowe żele EMSA / SDS-PAGE poddano nieradiolakierowanej sondzie; położenie kompleksu w pierwszym wymiarze wywnioskowano z radioznakowanych powtórzeń, a fragment żelu wycięto i wstawiono na wierzch żelu SDS. Jako kontrolę negatywną ekstrakt jądrowy bez DNA prowadzono równolegle w pierwszym wymiarze (EMSA), a obszar odpowiadający kompleksowi przecinano i prowadzono razem z rzeczywistym kompleksem w kolejnym drugim wymiarze (SDS-PAGE). Do analiz spektrometrii mas kompleksy nieznakowanego FTS-1 zidentyfikowano przez odwracalne barwienie srebrem (SilverQuest; Invitrogen) i dopasowano do próbek znakowanych radioaktywnie równolegle. W każdym doświadczeniu, wybarwione kompleksy wycinano z żelu i poddawano trypsynizacji przed analizą. Chromatografia powinowactwa do DNA. Zwykłe i zmutowane 100-bp biotynylowane tetramery oligonukleotydu FTS-1 o 25 pz wykonano na zamówienie przez Invitrogen i przyłączono do Streptavidin Dynabeads M-280 (DYNAL, Invitrogen). Kompleksy specyficzne dla FTS-lp utworzono z ekstraktów jądrowych fibroblastów w warunkach opisanych dla EMSA. Ekstrakty jądrowe inkubowano najpierw ze zmutowanym tetramerem, a przepływ wykorzystano do wtórnej inkubacji z normalnym tetramerem FTS-1. Kulki przemyto 3 razy buforem do inkubacji, a frakcje wymywano 0,5 M KCl, a następnie tym samym buforem plus 5 M mocznikiem. Eluaty połączono, dializowano wobec 10 mM Tris-HCl pH 7,5 i analizowano za pomocą EMSA pod kątem ich zdolności do tworzenia kompleksu FTS-1. Pozytywne frakcje poddano trypsynizacji i poddano tandemowej spektrometrii mas w celu identyfikacji peptydów. Analiza spektrometrii mas. Mieszaniny peptydów rozdzielono i analizowano stosując mikrokapilarną HPLC w układzie faz odwróconych (RP-HPLC) sprzężoną z tandemową spektrometrią mas (25). Mieszaniny peptydów naniesiono na kolumnę RP-HPLC o średnicy 75 .m (średnica wewnętrzna) (Poros R2, Perceptive Biosystems) zrównoważoną 0,5% kwasem octowym i eluowano, stosując liniowy gradient 0%> 40% acetonitrylu przez 60 minut, a następnie 40%. 60% przez 10 minut przy prędkości przepływu 0,3 l / min. Wyeluowane peptydy analizowano metodą spektrometrii masowej z jonizacją przez elektrorozpylanie, stosując spektrometr masowy z pułapką jonową (Finnigan LCQ Deca, Thermo Scientific). Wszystkie spektrum tandemowe przeszukiwano w bazie danych białek nieredundantnych NCBI (http://www.ncbi.nlm.nih.gov/RefSeq/) przy użyciu algorytmu SEQUEST (25, 61). Wytwarzanie stabilnych linii komórkowych MCT / rCBF-A. Wektor ekspresyjny CBF-A / CBF-A, pSR-CBFA-N, powielono przy użyciu systemu Advantage PCR (Clontech) z następującymi primerami: 5. starter zawierał nawis z unikalnym miejscem restrykcyjnym Bglll (ATTAGATCTGAGTAGCCGCTGCGGCCTGGCCGACCATGT) i 3. primer (ATTCTCGAGTCACTCGGCCGCTCCTGCTGCCTCTCAGTA) dodał unikalną stronę XhoI
[patrz też: lipaza lipoproteinowa, leczenie odleżyn, lamblia objawy ]