Ehrlichia ewingii, nowo rozpoznany agent ludzkiej erlichiozy cd

Produkty rozszerzeń analizowano w zautomatyzowanym sekwenatorze DNA (model 373A, Applied Biosystems). Dane dotyczące sekwencji uzyskane z reakcji zainicjowanych przez co najmniej dwa startery dla każdego produktu PCR przetworzono za pomocą programu Factura (Applied Biosystems) i dopasowano do znanych sekwencji z GenBank i innych sekwencji eksperymentalnych. Tabela 1. Tabela 1. Charakterystyka kliniczna czterech pacjentów z zakażeniem Ehrlichia ewingii. Do sekwencjonowania dużych części genu 16S rRNA zastosowano dwie inne metody. W Washington University School of Medicine, produkt o objętości 1360 pz z zagnieżdżonego testu PCR amplifikowanego z próbek krwi od dwóch z czterech pacjentów z próbkami dodatnimi pod względem E. ewingii (pacjenci 3 i 4 w Tabeli 1) został zsekwencjonowany przy użyciu 8F i 1448R jako startery zewnętrzne, a 15F i 1442R jako startery wewnętrzne. W Centrum Kontroli i Zapobiegania Chorobom (CDC) amplifikację 16S rDNA z próbek krwi pełnej przeprowadzono zgodnie z metodą Anderson i wsp.3 z dwoma wyjątkami. : starter EC12A (5 TGATCCTGGCTCAGAACGAACG) zastąpiono EC12, a produkt PCR zsekwencjonowano bezpośrednio. W przypadku Pacjenta 3, 2 .l próbki mieszaniny reakcyjnej zastosowano jako matrycę w najkrócej zbadanym PCR ze starterami EC12A i EC11.3. Produkt sklonowano w wektorze klonującym TA pGEM-T (Promega, Madison, Wis.) I sekwencjonowany zestawem dRhodamine (Perkin-Elmer) i automatycznym sekwenserem (model 377, Applied Biosystems).
Analiza serologiczna
Próbki surowicy i osocza otrzymane od pacjentów w fazie ostrej i zdrowej oceniono w CDC z pośrednim testem immunofluorescencyjnym na przeciwciała IgG reagujące z E. chaffeensis. 18 Miano punktu końcowego zarejestrowano jako odwrotność najwyższego rozcieńczenia wykazującego swoistą fluorescencję.
Próbki surowicy od Pacjentów 1, 2, 3 i 4 oraz od dwóch psów należących do Pacjenta 3 i jednego psa doświadczalnie zakażonego E. ewingii testowano za pomocą analizy Western blot z preparatami E. chaffeensis i E. canis, które były wolne od gospodarza. komórki (oczyszczone chromatograficznie) jako antygen, jak opisano wcześniej19, ale z następującą modyfikacją. Membrany testowe inkubowano z surowicą ludzką lub psią w rozcieńczeniu 1: 1000, a następnie z preparatem skoniugowanej z peroksydazą oczyszczonej metodą powinowactwa antyludzkiej IgG, IgM i IgA (Kirkegaard & Perry Laboratories, Gaithersburg, Md.) Lub z antidog IgG o 1: 2000, a następnie kąpanie w roztworach rozwijających się i hamujących.
Wyniki
Pacjenci
W latach 1994-1998 próbki z 413 pacjentów z możliwą erlichiozą testowano za pomocą PCR. Łącznie 60 próbek (15 procent) było pozytywnych dla gatunku ehrlichia: 56 dla E. chaffeensis i 4 dla E. ewingii. Wszyscy czterej pacjenci z E. ewingii byli mężczyznami, żyli w Missouri i mieli gorączkową chorobę między majem a sierpniem 1996, 1997 lub 1998. Byli w wieku od 11 do 65 lat, a wszyscy zgłaszali, że byli narażeni na kleszcze przed ich choroba (tabela 1). Trzech z czterech pacjentów otrzymało terapię immunosupresyjną w przypadku schorzeń podstawowych. Wszystkie cztery miały gorączkę i ból głowy, co spowodowało nakłucie lędźwiowe w trzech. Wszyscy czterej pacjenci mieli małopłytkowość (<150 000 płytek krwi na milimetr sześcienny), a u dwóch wystąpiła leukopenia (<4500 białych komórek na milimetr sześcienny) [patrz też: leczo kalorie, bikalutamid, Enterolnutrend ] [więcej w: leczo kalorie, legionelloza, leniwe oko ]